Comrades, Emerald Robinson is a journalist who works for Newsmax as a White House corespondent. However, Emerald Robinson is also a free thinker who challenges communal orthodoxy and rebels against groupthink. In short, Mrs. Robinson is a subversive voice who refused to correct her thoughts and become a stenographer for the regime.
As a result of her failure to comply with the correct thinking necessary for good citizenship, her employer, Newsmax, has suspended her tenure. Apparently Mrs. Robinson did some research into the COVID-19 vaccination ingredients and posted her results in a substack article {SEE HERE}.
The Ministry of COVID Compliance was not happy with Mrs. Robinson and requested she attend further re-education {SEE HERE}.
The compliance division of Thought, Wellness, Information, Transitional Training and Enhanced Re-education (aka ‘TWITTER’), attempted to control the public broadcast of wrongthink and suspended her account. Unfortunately, dissident Robinson remained non-compliant and initial re-education efforts failed to produce the intended results {SEE HERE}.
The monitors within the Thought, Wellness, Information, Transitional Training and Enhanced Re-education platform were forced to make the subversive suspension permanent, thereby ensuring the wrongful expressions did not create collateral damage or extend the transmission of unapproved vaccine information {SEE HERE}.
It has never been about health or safety.
The shots are an attack on humanity. The shots cure and protect nothing.
No one should be surprised. Just listen to what they’ve been saying for years.
In my house, we call them ‘kill shots’.
You are right.
BUT the deeper issue is how to avoid branding as “extremists.”
Make the case right up front.
Even IF vaccines help, the worst side effect of all is not physical. it is letting the left impose obedience.
Absolutely! Thats been the Marxist over all plane for 100 +/- years.
Peer pressure, trial by jury
Ted Nugent as judge!
I sent this to you guys last night. Please read this gives me chills.
https://emeralddb3.substack.com/p/what-is-luciferase
Just read this in what Sundance posted, Para 2 {see here} – Chilling for sure!!
Go to Emerald’s list of articles on Substack, and you will find a recent story about the new covid antibody test…
It is called SATiN.
I put it up two-three days ago here. Am surprised it took so long for any to pick up on it before.
Ah well, we try, no one listens 😉
Jeans, I miss discussing the John B show with you. Since the change, I try to listen sometimes – but it has been mostly annoying. What say you?
Better late than never friend. Got this from a certain SEAL I follow on GAB. Thanks MB!!
I did and I subscribed to her site, THANK YOU Jeans2nd — was $70 for year I believe. I will ONLY support those who present facts and challenge group think — Just as I donated to her I also donate to this wonderful site BECAUSE Sundance and TCTH is my go-to site when I want to get real news! Yellow Donate button in right upper corner of this page – go make Sundance’s day 😉
Happens all the time.
Keeping up with the info presented here is like drinking from a fire hose.
Emerald is a kook. The Luciferase stuff is a year past the time it broke. Why is she latching onto this now? Grifting, is my guess. Twitter et al are fascist, and COVID19 is certainly a complete joke and lie, but Emerald is the wrong horse to bet on. Just like Loon Wood and Sidney Krackenhead she’s a detriment to the cause, overall.
Tough truth to handle, but truth nonetheless. Let the chaff separate from the wheat.
Yep, we have got to police the kooks. I’ve made the same point.
Which presents a more compelling argument that people should be skeptical of the vaccines?
Case Fatality Rate (CFR)/Trump/no vaccines/1.7%. CFR/Biden/forced vaccines/2.1%. More people have died of COVID since Biden took office and a greater percentage of people who catch COVID19 die since Biden took office. The CDC and FDA no longer call breakthrough cases “extremely rare” and the CDC director has stated that vaccinated people are not immune from covid19. There are documented cases of people of all ages suffering debilitating injuries and death from the vaccine. The Government states that this is rare, the same term the Government used to use to describe breakthrough cases. You are not allowed to sue the manufacturer if the vaccine harms you or a family member.
vs.
Luciferase – aka Lucifer, or Satan – is a compound which Government scientists at DARPA/DOD have secretly contracted to have included in the Moderna vaccine so that they can use the bioluminescent properties of LUCIFERase to control and track the vaccinated population. The Government is hiding the true vaccine ingredients and the ingredients posted on the CDC website are false. The pharmaceutical companies have secret agreements with governments around the world that nobody has any independently-verifiable copies of to suppress the dangers of the vaccines and hide the secret ingredients.
Which one is most likely to attract sane people, and which one is going to attract and incentivize kooks?
“Police the kooks” ? Who decides who the “kooks” are? .. You? That is the kind of thing that NRO used to say and it was pretty much just a virtue-signal to the Left which is why Victor Davis Hanson left them.
“I think there were certain people in the Republican movement, or establishment, who felt it is their duty to internally police their own, and that’s kind of a virtue signal to the left.”
https://www.realclearpolitics.com/video/2021/10/05/victor_davis_hanson_why_i_left_national_review.html
You are trying to persuade people to agree with you. Which of these two arguments is more effective:
vs.
Now, you are free to believe the second one. But if you wonder why so many people are not persuaded, consider trying the first one instead.
Hold on, you don’t think the government is capable of evil? Evil, like sacrificing millions of people to win an election, evil? Allowing narcotrafficking to destroy our Nation so they can get more slaves/votes, evil? How about the human trafficking, evil? How about the rampant pedophilia, evil?
And don’t forget the RATS favorite evil … slaughtering 70+million innocent babies for money … and selling their itty-bitty pieces parts for even more money
Depends on who’s listening. Arguments aren’t generally won with facts and numbers. I wish it wasn’t so but it is. Ask Madison Ave.
Lucifer root word just means LIGHT. It could be End-Times satanic, or it could just be agnostic techies playing around when they name things. Just like the Ivy League boys play around with their initiation rituals, or elites play around with “owl” rituals in their off-limits northwest forest lodge. Fools all IMO.
I understand from Emerald’s site that the test to check for the presence of Luciferase
(indicating that one is vaccinated) is named SATiN.
Lucifer was God’s favorite Angel … then Lucifer decided he wanted to be God … St Michael The Archangel defeated Lucifer and his angel followers.
Now … Lucifer is Satan and he and his evil foot soldier angels prowl the earth spewing evil.
Your argument of case fatality rates Trump vs. Biden is flawed. There were far fewer vaxes administered in the Trump administration vs. since Biden took office.
That’s my point! When Trump was president, and no vaccines were available, the case fatality rate was lower, 1.7%. Since Biden, and since the vaccines became widely available, the case fatality rate has increased to 2.1%. In total numbers, more people have died from COVID since Biden was elected, ostensibly because he claimed he could do a better job.
Yes, we have to police the kooks.
FYI – luciferase is not named after “Lucifer”. It’s named for the latin word “lucifer”, meaning “light bearing.” Robinson incorrectly capitalizes the word in her substack (the patent does not).
And the patent Robinson refers to does NOT state that this enzyme is in the vaccine.
We have to police the kooks.
And Robinson is a kook.
You assume Covid is not real I suppose. You give us a bad name. I can assure you there’s something going around that is different from the flu or cold. People like you do not help the cause. Perhaps that’s your intention. If you are honest than so be it but your are fighting a battle that makes all of us look stupid. Last year I was curious as we got into the fall. But after Delta I know there’s something about it. No they have not isolated it. Keep that mind going forward.
Can you explain why “they” would name a product LUCIFERASE or SATin? Asking for a friend.
Because His word will not return void.
I have satin sheets. Do I need to go to confession now?
The luciferin compound was first discovered and isolated in the 1800’s by a scientist named Raphaël Dubois. Its root word is derived from ancient Latin lux for “light” and ferre for “to bring or carry and the terms predate Christianity by hundreds of years. He also coined the terms proteon and bioproteon, from the Greek “proteon” for matter and “bios” for life. Bioproteon means “living matter”.
Luciferin and luciferase are used commonly in microbiology and have been used and studied for over a hundred years.
Yea, the creator of the Universe would never use something that man discovered 100 years ago. (sarc)
Lucifer predated Christians, Jews & Adam … but … as the snake that he is … Lucifer got Adam & Eve kicked out of paradise … and now as Satan -his evil foot soldiers prowl the earth and control the demonRAT party.
I had never heard of this enzyme before I saw this article on CTH.
I used Google to look it up.
I learned that “luciferase” (correct spelling is all lower-case) is named for the latin word “lucifer”, which means “light bearing”.
It’s not named for the devil.
Must be easy to take pot shots while you’re sitting on the sidelines, huh?
What have you done to promote “the cause” ?
Tearing others down is a fools play.
What exactly makes Emerald a kook?
Yep. The patent she refers to in her substack does NOT state that the luciferase enzyme is in the vaccine.
What the patents does do is make many references to the use of the lipid-delivery mechanism (which is what the patent covers) has been used to deliver Luciferase into animals for cancer tumor research.
And – the patent does not capitalize the word “luciferase”, because the name is derived from the latin word “lucifer”, which means “light bearing.” Robinson capitalizes it to falsely suggest that the enzyme is named after the devil.
I read it too, but how does that work, actually? In the lab, you have to actually insert that into the genome, then check if the thing glows or not (or how brightly it glows). The patent itself can be found here:
https://patents.google.com/patent/US10703789B2
It’s a huge stretch to say “this thing is in a patent, therefore it’s in the vaccine” though. Patent lawyers normally try to patent every possible variation of a thing, including those which might only be used when testing (e.g. to make sure the spikes are getting produced by the cells given the vaccine and for how long).
Also, there’s an easy way to tell if luciferase is present: it glows like a firefly or lanternfly does. I dunno about you, but I haven’t seen anyone with glowing syringes. Also the patent gives the exact sequences for the luciferase proteins used (yes, there’s more than one). This is also quoted on Substack:
LUC1 GATGAAAAGTGCTCCAAGGA Luciferase26
LUC2 AACCGTGATGAAAAGGTACC Luciferase 27
LUC3 TCATGCAGATTGGAAAGGTC Luciferase 28
I checked the FASTA sequence for the Moderna vaccine, which may be found here, but those sequences are not present:
https://github.com/NAalytics/Assemblies-of-putative-SARS-CoV2-spike-encoding-mRNA-sequences-for-vaccines-BNT-162b2-and-mRNA-1273/blob/main/Figure1Figure2_032321.fasta
And as anyone who has handled fireflies before should know, this stuff doesn’t last particularly long. We used to squish the poor things but the glow wears out in a few seconds, so you would have to get the body to make this stuff like with the spike proteins themselves.
Given that I do not see this in the sequence for the vaccine, this conclusion does not appear solid to me. I have yet to see any reports of glowing syringes, even if there were, this stuff doesn’t glow for long, and you’d have to permanently alter the DNA to insert this. The mRNA which was extracted by 3rd parties (and which anyone with sufficient training can do) and contains neither the luciferase sequences nor any mechanism to copy this into the hosts DNA. This is intentional, because it’s there to make spike proteins for a few days, make your immune system cry like a leftist, then go away via the body’s natural defenses against foreign mRNA.
Going back to the Bible, Revelation 13:11–18 says this:
11Then I saw another beast rising out of the earth. It had two horns like a lamb and it spoke like a dragon.12It exercises all the authority of the first beast in its presence, and makes the earth and its inhabitants worship the first beast, whose mortal wound was healed.13It performs great signs, even making fire come down from heaven to earth in front of people,14and by the signs that it is allowed to work in the presence of the beast it deceives those who dwell on earth, telling them to make an image for the beast that was wounded by the sword and yet lived.15And it was allowed to give breath to the image of the beast, so that the image of the beast might even speak and might cause those who would not worship the image of the beast to be slain.16Also it causes all, both small and great, both rich and poor, both free and slave, to be marked on the right hand or the forehead,17so that no one can buy or sell unless he has the mark, that is, the name of the beast or the number of its name.18This calls for wisdom: let the one who has understanding calculate the number of the beast, for it is the number of a man, and his number is 666.
This appears to reference gematria: https://en.wikipedia.org/wiki/Gematria and Nero(n) Caesar is capable of explaining both the normal and variant manuscripts which contained 616 instead. It’s hard for me to see how modified DNA to produce luciferase read by a chip of some kind makes any sense when they could literally just write a bar code or QR code on your head in ink if they wanted something like that. This seems like a ridiculously over-complicated way to make a mark that’s supposed to be a symbol of submission to the Beast. I rather think that will come as an open and visible mark to serve that purpose, but this is my own conjecture.
There are, of course, very good reasons for opposing vaccine mandates or cancelling that makes anyone unable to buy or sell any more without government approval, regardless of whether these are the mark of the Beast or not. I oppose such myself and intend to continue to do so.
I don’t know if Luciferase has even been used yet. Maybe so but not sure. Emerald found it in the parents. Again not sure if that’s current crop or future. I do know that taking these vaccines are like playing Russian Roulette.
It doesn’t appear to have been–it’d either glow or make you glow and nobody has shown any glowing syringes of vaccine. This is the kind of thing you’d use when testing to make sure that the spike proteins are actually being created as a result of the mRNA. The spike proteins are hard to see or count, but glowing is easy to measure, so you add an extra sequence to the mRNA to make luciferase and the cells will glow under a microscope and you can measure that.
This only makes any sense during testing and we know it’s not there because we can sequence the mRNA from Moderna relatively easily, especially if you get your hands on a sample of the vaccine itself. The links I gave show that the sequences are not in there, but if you have the know how to sequence a genome you can do your own tests directly.
Honestly there’s no zero risk option here. Yes, the spike proteins are probably harmful but Covid produces even more of them, so you’ve got myocardidtis and similar risks whichever way you go.
I’ll just leave this here for consideration.
https://www.raptureready.com/2021/10/31/anomalies-or-signs-by-jim-towers/
Patents also include the manufacturing and quality control processes. Based on how luciferase is used in other research and medicines – nobody cared about the name until a week ago after 100 years – it sounds like it is a non-invasive way to check if the chemical reaction you wanted to happen actually happened.
If the compound were included in the vaccine, it would probably be pretty easy to spot with the proper equipment because as the proteins are created, the photons would fire off.
Yes, exactly. You’d literally glow like an FBI agent if you had this stuff.
Don’t get me wrong–they WILL eventually try to mark everyone. But I suspect they’ll brand people like cattle by that point in the degeneracy spiral.
Took a look at her link where she claims to have evidence of luciferase in the Moderna gene therapy…..not so sure, at least from what she posted.
According to the article, primers that may be used in PCR reactions to verify constructs include primers to sequence a luciferase gene.
However, the same table also includes primers that may be used to sequence constructs containing genes for G-CSF (granulocyte colony stimulating factor…a growth factor that increases white blood cell production in bone marrow) are well as primers for acid glucocerebrosidase [involved in lipid metabolism; inherited deficiencies lead to the lysosomal storage disorder known as Gaucher’s disease).
Sounds to me like they are looking at other things to use their LNP gene therapy for by making additional constructs using genes other than the spike protein gene. G-CSF and acid glucocerebrosidase are genes that may actually be used (at some point) in gene therapy for corresponding deficiencies.
Not saying there is no luciferase in the Moderna gene therapy…..however, her post is far from definitive and, to be honest, provides zero evidence.
DEATH BY STARVATION
Impoverished Indians drop dead of starvation after Bill Gates-backed biometric “Mark of the Beast” system DENIES rice rations.
“Having branded Aadhaar’s creator, fellow billionaire Nandan Nilekani, as a “hero,” initiatives backed by tech oligarch Bill Gates have long sought to bring the “Aadhaar approach to other countries.” With the onset of the COVID-19 crisis, Gates and other mavens of the digital ID industry have an unprecedented opportunity to introduce their programs into the wealthy countries of the Global North.”
Oh yeah, I’ve been hearing about the glowing for a few months, And, about magnetic material too.
And see this one, discussing using something as a justification to hyperdrive the approval of MRNA vaccines, themselves just the delivery vehicle for the tracking chemicals. But they couldn’t wait 10 years for the normal testing and approval process. Great Reset was already scheduled and they needed to roll out MRNA NOW. So, covid-19, operaton Warp Speed, Sleepy Joe, economic crash, lockdowns, mandates, purges of the military and work force of vax refusers, and on and on. And they were discussing this in 2019.
Information is out there. You just have to let it in.
https://rumble.com/vnh8qk-fauci-hhs-officials-discuss-using-new-virus-from-china-to-enforce-universal.html
That is an excellent link, or you can go to C-SPAN without the host-talk:
https://www.c-span.org/video/?465845-1/universal-flu-vaccine
Anyone else notice how affected that Rick Bright guy is? Weird, weird, weird. Who wants him in charge of anything! Sounds like a sociopath, pretending to be normal.
The point of what Fauci was saying was that he was tired of culturing virii in chicken eggs,,, and wanted to try his pet “science project” of having the patient make the antigen.
That sure answered for me how we got here, with the mRNA approach.
Creepy also that the reported who moderated wanted to “blow up” the system that creates vaccines… and bypass everyone’s objections. That’s pathological thinking.
This is the plan, they were merely waiting for a pretext to put it into action. They thought it might be an outbreak of avian influenza (“bird flu”); as it turned out, it was the novel coronavirus COVID-19. They found their crisis and like good little bureaucratic hacks they didn’t let it go to waste. The triggered the war plan against a virus that turned out to be nowhere nearly bad enough to justify the draconian measures invoked.
And anyone who see through the subterfuge must be silenced, banished, and un-personed.
If Newsmax didn’t have Big Pharma ad revenue they would have to shut down.
They know not to bite the hand that feeds them.
Newsvax ?
Ha ha ha. Next republican idols to fall are Tucker and Bannon. When will people learn?
Caught Tucker in a lie tonight. Does that count?
Tucker said there is no vaccine mandate at Fox.
Earlier this evening Steve Hilton was on TimCast IRL and said Fox required skin penetration (the vaccine) or tests every week.
What is that if not the mandate?
And most already realize Bannon is nothing but a grifter.
One test a week? I would take one test a week if it meant I didn’t need to get the vaccine.
Annoying, yes, but I would do that in the interim while trying to end any vestige of a mandate.
Not so fast wait until they start with nasal swabs loaded with who knows what going up your nose
Sorry no shot no swab I’d like stay alive
So then you’ll go ahead and participate in that system. Maybe they’ll just go after you last, because the goal is that everyone will injected with their “software”, tracked, and scored according to their obeisance, compliance to whatever the next rules of the game will be. But hey, this is just annoying, yes? Okay then just take their little ‘mark’ to make sure you can be monitored 24/7, whatever that mark might be. Unbelievable. – https ://www .globalresearch. ca/testaments-blood-samples-establish-global-dna-data-bank/5759083
Bannon is a grifter and Tucker Lied
Arche and jeans2nd,
There are about 25 useful patriotic members of Congress. The rest are liars and grifters.
Carlson and Bannon constantly expose the liars and the grifters in Congress and elsewhere while you sit on your ass.
Bannon and Carlson are doing a good job. Your carping just shows you are one of the grifters and liars or just a plain RINO. Buzz off.
What a shame, she does a great job! We are at war, enough crazy!
Hell I just paid homage to you. Got Emeralds substack from the feed. lol even got NC to post it. Been reading and listening to you since last year. Was never into prepping because that was for paranoid fools. Well now I’m a paranoid fool ?
Better late than never Luke…..hard times ahead. Good to be prepared!
Emerald is a reporter, not a geneticist. People mocking her use of luciferase are purposefully misleading us or low IQ.
the point of her bringing up luciferase is simply to help people understand you are dealing with a biotechnology genetic engineering product and not a vaccine.
the topic of luciferase draws eyes and brains to a genetic product versus a vaccine.
this allows us to expand upon this discussion into the other MORE DANGEROUS more effective at gene regulation and editing products that accompany insert vectors like luciferase.
its an introduction……
next you learn of the *** restrictive enzyme *** locations – that can cut and fragment and create ‘seperate products’. ‘seperate gene regulators’, ‘hitchhiker products’ on the so called spike protein insert we are all focused on.
introduction. conversation starter. public learning. public asking questions.
Goal = to END the use of BIOTECHNOLOGY disguised as a vaccine, until the public has been informed and has had their input considered.
That is not what she is saying at all. I read her subpost. She is claiming that DARPA/DOD have a secret plan to track us all using the bioluminescent properties of luciferase which she claims is a part of the vaccine. That is Level 7.8 of 10 kookery.
This is something that is actually pretty verifiable scientifically, and there are labs in this country where samples of people’s blood could be taken and tested to determine if the vaccine is bioluminescent in the sample.
“Hey look! I found a testing regime used throughout microbiology that contains the word lucifer!” cue scary musical undertones. “I didn’t bother to talk to a friendly microbiologist to see if we could detect bioluminescent activity in a vaccinated person’s blood. I just jumped straight to DARPA/DOD and the police state.”
Persuasion starts with not sounding like a nut. There are plenty of pretty mundane but provable reasons not to get vaccinated: religious convictions, lack of adequate safety testing for long-term side effects, actual cases of death and serious injury for which the manufacturers enjoy lawsuit protection, and the simple fact that the vaccine doesn’t stop you from getting of spreading covid19.
We don’t need this kind of trouble, and I’m gettin’ pretty darn tired of hearing “Conservatives” whine and bitch and moan about Twitter. Eff Twitter, and shame on people who still have an account.
The questions that needs to be answered are:
What is the REASON to include Luciferase in the vaccine patent?
Would a bioluminescent enzyme be used for any other reason than make something ‘observable?’
Kookery? Possibly. But how many kooky theories these last two years have ultimately been played out as fact.
There are references to using the compounds throughout microbiology. Apparently, when included in the testing, it generates photons when the proteins are created or binded (I’m not sure which). When I read through the patent materials (albiet briefly) it appeared to be in a list of testing protocols which is normal in a patent to include the manufacturing process.
But to me, I think if I’m a reporter asking questions, I might start with, “Let me go talk to some microbiologists and find out what this is actually used for” without mentioning the COVID19 vaccines. Just some simple nonGoogle websearching brings up mundane uses of it throughout various biochemistry disciplines.
The stuff has been named and studied and used for over 100 years. Like I mentioned earlier, nobody cared about the name of it until a week ago, or that it is from the Latin lux and ferre which mean “to bring light”. It’s unlikely the guy who named the glowy stuff in lightning bugs realized the double meaning that hypersensitive Christians 100 years later would apply to it.
When I recently heard about this luciferase story, I found it creepy; however, upon looking for the definition of the term, found it had been coined by 19th century French scientist Raphael Dubois. He invented the words luciferin and luciferase, for the substrate and enzyme, respectively. Both words are derived from the Latin word lucifer, meaning “lightbearer”, which in turn is derived from the Latin words for “light” (lux) and “to bring or carry” (ferre).
Yep. I spent maybe 15 minutes last night, learned the same things (I always like to know the etymology of words), and also found that luciferase/luciferin are very commonly used across many microbiology/biochemistry applications…mainly as a non-invasive way to determine if the chemical reaction you wanted is the chemical reaction you got. (like in 11th grade chemistry when something would glow, heat up, or smell differently which are also non-invasive ways of verifying the chemical reaction)
While trying to find how Luciferase works, I found research that could be used to inject dyes that react to infrared that can be seen by specially modified smartphones.
Storing medical information below the skin’s surface | MIT News | Massachusetts Institute of Technology
Of course it is all for a good purpose, not population control, not at all. /s
But this, if the research is successful, could do what people are claiming Luciferase is doing. Luciferase is not likely to work in that fashion.
Here is a description of a different use of Luciferase. The Luciferase Reporter Assay: How it Works & Why You Should Use it (bitesizebio.com)
look up “blood test on the skin” antenna
Feds attempting to ban Xlear (an over-the-counter Xylitol based saline nasal spray) that kills and prevents Covid 19
(I use it daily)
https://www.zerohedge.com/covid-19/feds-seek-block-promotion-nasal-spray-against-covid-19
I used it and I still got Covid, it did help with the worse congestion I have every had. My nasal passages were so dry and it was the only thing that gave me some relief.
Moronic move by Newsmax. Emerald Robinson is an excellent journalist; the best they had. I’ll happily follow her reporting and drop Newsmax.
I’ve never understood the mass rush to Newsmax. It’s a RINO network. OANN is so much better.
I would say Newsmax is doing the bidding of the RNC and Bush republican allies. They’ll let Greg Kelly go MAGA as a hook and even broadcast Trump events, but they are designed to catch the disaffected Fox News viewers who dropped Fox after the 2020 Election night.
It sickened me when hardcore Never Trumper Rick Santorum was their “big” analyst for last week’s election night coverage. That’s the same playbook Fox used before the 2020 election – ensure all on-air commentators were Never Trumpers and RINOs. Santorum is aligned with the Republican Senate leadership.
Yes, when I saw they hired Santorum, my Rino alert went crazy. Ihmo, he is a sanctimonious elitist, globalist BUSH.
Chris Ruddy was a big Herliary Clinton donor.
In what must be damage control for them, tonight’s ticker on the channel has “Newsmax is firmly opposed to vaccine mandates” as one of the headlines. Caught it during Greg Kelly’s show.
2021 FOX NEWS is 2010 CNN
2021 NEWSMAX is 2012 FOX NEWS
It’s so transparent how conservative viewers were supposed to migrate over to Newsmax once Fox News dropped their mask. That is clearly and obviously by design. The Intelligence community and Federal government are increasingly worried they are losing their propaganda outlets aimed at conservatives and non-Democrats.
The only actual conservative news channel is OAN. The others are run as controlled opposition. Remember that the next time you see something from Fox or Newsmax. Always consider the expected public reaction to any piece of news and how that serves the agenda.
I am with you, R Green.
In my opinion, she is NOT a kook for reporting on Luciferase and SATiN.
She is not a kook for boldly stating that she is a Christian, and that the Bible is the Word of God.
Too many folks dismiss light-shedders because what they reveal sometimes sounds like science fiction, and because they are emphatic as they point to the ungodly consequences of what they have revealed.
At this point, don’t worry about stopping her, focus on promoting the story.
Our objective isn’t to reform the opposition, or shame our Repubs in Congress, but to awaken as many people as possible.
Mrs. Che here can help us do that.
Sorry, wrong thread.
“You will know the mark by its name, which is the name of the beast: the enemy of all mankind who, before he fell, was an angel of light named Lucifer. That’s why “Luciferase” should send a chill down your spine.”
Indeed it does!
She’s too good for them.
Newmax has always been another fake news outlet claiming to be something they are not. Hiring Sean spicer and then hiring CNN employees should be enough to never turn them on again.
Emerald is speaking the truth and all people have to do is go to the Moderna website and look at the cRNA and description of the ingredients and Luciferase is listed in the ingredients 3 times.
Spot on, Sanajc. Newsmax is a joke.
That effort shows virtue,
and it loves thy neighbors.
Thank you Emerald
(and thanks Sundance for the compilation, and providing ‘sun’ shine on a true, worthwhile story, plus more…)
What’s even greater,
is overcoming the hurdles etc.
and that the FACTS, the content is being shared – with our neighbors and the knowledge multiplies ….
Thank you
Faith and good works… in actions …
James 2:22
There is strength, in numbers, united for selfless purposes….
HIS truth is marching on… (Hymn of the Republic)
Video, with message, for all….
https://www.godtube.com/watch/?v=7KLWGPNX
Thank you, gymcy81
Here is Emerald’s interview with John Fredericks from this morning, where Emerald admits to and outlines her subversive history and comments on her current situation and activities.
Rumble link –
Emerald Robinson Gets Banned from Twitter for Documenting Findings 10:48
https://rumble.com/embed/vmcme1/?pub=4
Huh. A reporter might have gotten something wrong or unclear and she is suspended.
Seems like an extreme over reaction if the Lucifer’s tag is really no big deal.
Lucifer’s stuff is also going to be in the new PCR replacement test called “Satan’s” er Satin.
I wonder if someone will get fired for that, proobabbly lol, inconsequential thing?
So much for Newsmax being a “conservative” alternative. But this should really help their ratings. ?
I read the piece and found it very interesting. Not the Christian similarity of names thing even though I consider myself a Jesus freak, I find the biblical name similarity only mildly interesting. The most interesting thing was her choice of quotes. Luciferase is essentially a tracking mechanism for biological creatures. It’s luminescent quality can be detected and measured. A method unknown has been developed to break it into pieces and render the tracking function essentially useless unless and until it is exposed to the virus or something perhaps very similar to it like its own mutation(s)? It then begins to glow again. Very interesting.
I’ll just leave this here for your consideration.
https://www.raptureready.com/2021/10/31/anomalies-or-signs-by-jim-towers/
Just like that, Gates appears to be wiping his hands clean of his involvement in the worldwide mRNA experiment
https://dossier.substack.com/p/with-74-billion-covid-shots-deployed?token=eyJ1c2VyX2lkIjo0MTkwMzU5MywicG9zdF9pZCI6NDM4MDQ5MjksIl8iOiJsQ2xGWiIsImlhdCI6MTYzNjUxNTI2OCwiZXhwIjoxNjM2NTE4ODY4LCJpc3MiOiJwdWItNjkwMDkiLCJzdWIiOiJwb3N0LXJlYWN0aW9uIn0.mmANunJtKgvGz6JLVWbfIymyZ97z9CAGxDz787-7VJk
It was always a false “vaccine” in search of a manufactured virus.
https://rumble.com/vozc1m-brianne-dressen-if-the-government-wont-help-us-who-will-help-us..html
This is heartbreaking. I was crying.
I heard a recording of this last night on a Christian radio station and wanted to forward it to those in my family and some friends who are still clueless about what is really going on in the world and about the vaccine. Her testimony was compelling and sincere. Thanks for posting this!
She joins some of the finest in the ranks. Wear it like badge of honor ?
Only 4 corporations own nearly the entire media. Blackrock is the major investor in all 4. Billionaire dirt bags control most of the info. It`s not working anymore though!
This may be the 1,400th time this year that I laugh and point out that no sane person calling themselves a Conservative would be caught dead with a Twitter account.
That being said, the perhaps unfortunately-named luciferase/luciferin – which roots back to the Old English word “brings light” or something like that – is just a chemical that creates bioluminescence in creatures like fireflies which I’m no expert but I’m pretty sure fireflies are not Satan’s minions.
A non-invasive way to test whether your protein did its thing is to include luciferin which emits photons that can be measured. We would all sound a lot less crazy if we just worked with “Science!” to drop off some samples of a vaccinated person’s blood and run the test to see if it is emitting photons. I doubt it’s even a particularly tough test to run since it’s a pretty standard methodology in microbiology. I haven’t asked her, but my daughter is a budding Biochemist at ASU, and I would wager this is something she has done in the lab.
There are a lot of reasons not to get vaccinated: personal choice, long-term studies not done, actual documented deaths and injuries, religious convictions, or the simple fact that the Government has no right to inject you with an experimental vaccine.
We don’t need to sound like the DaVinci Code to beat this. In fact, if we’re going to beat this, we have to control the kooks who make everyone else look nuts.
Here’s a test. Which is a more effective, persuasive, argument?
On 1/1/2021, the COVID19 case fatality rate, pre vaccine, was 1.7%. Today, despite better treatment protocols and forced vaccination policies, the CFR stands at 2.1%. More people have died since Joe Biden was installed than during the Trump Administration. The vaccines are not making a difference and may in fact be making things worse, and it is obvious that Joe Biden has no answer to this problem.
or.
Moderna has a secret undetectable ingredient called luciferase that shares a common root with Lucifer, aka Satan. The drug companies refuse to provide their list of ingredients and we think that luciferase is part of a super-secret DOD/DARPA program to track vaccinated people using the bioluminescent properties of the luciferase compound. We don’t know why this would be useful or how 12 photons can be detected without an invasive procedure, but we’re pretty sure Bill Gates wants us all to die.
Just objectively, which one is going to attract more of the kinds of people we want to attract to our cause?
Was it here or another site that linked to Washington Examiner? They have decided to have long term fight against xiden’s regime by writing a long series, going into next year, about this war against us. I can’t find the link at 2am, but they have decided to call us out to the devastating truth; we ARE at war with our elites and government.
The only thing is on this, I read the accompanying article that Ms. Robinson linked to, and they stated that they are using an enzyme that is the same enzyme that causes fireflies to glow. Well, I looked up “what enzyme causes lightening bugs to glow”, and they do call it luciferase.
Now, I don’t know how long the name has been in use for the lightening bugs. But if it is the same enzyme, and Moderna patented it. This could be likened to how Merck originally patented ivermectin, although that was discovered from nature and not by them.
Just a thought, regardless of the fact these people are devoid of our Triune God and probably do worship Satan. When I did first read her Luciferase article a few days ago, it did creep me out, but now I wonder since it is this enzyme that someone named from nature.
But why do they need antibodies to “glow’ in the first place? Were they not able to use what technology we have? How else did the UK surveillance report show that those who are vaccinated and later get infected have very low N-antibodies compared to those who have been infected and never got the vaccine? Why do we need to light up the antibodies, are they not distinguishing between the types of antibodies such as what the UK surveillance report counted? Is this more of a way to disregard and hide the f-d up immune system a vaccinated person will end up with, with deficits in certain antibodies? So, just check and see if you have glowies without differentiating the types of glowies?
That might be a bigger question, at least for me. That and how long have they been calling the fireflies enzyme Luciferase.
Since the late 1800’s. A scientist named Raphael Dubois coined the term from the Latin roots lux (light) and ferre (to bring). The compounds have been studied for over a century. It is commonly used in microbiology and biochemistry applications as a non-invasive means to verify reactions at the molecular level which cannot be observed directly. Anybody who took 11th-grade chemistry has done something similar: using heat, light, sound, and smell to determine if the chemical reaction took place. It’s just another form of indirect measurement, and the patent lists it in what appears to be the manufacturing/testing process which would make sense since the bioluminescent reaction is triggered by the formation of the proteins the mRNA “vaccine” creates. I would bet that the detection equipment can even specify the type of protein-based on the wavelength of the measured photons. Wavelengths depend on the energy of the chemical reaction, which any decent scientist would know ahead of time based on the protein-reaction they are trying to create.
Nobody cared about the name until a week ago.
Thanks for the info!
Emerald Robinson has been such a good reporter, I can’t believe she didn’t investigate to make this connection as the article she even referenced. I don’t know why she is concentrating on the name and no context of its history. It does make us sound silly but I don’t think she should have been banned over it.
Gee. Of all the names in the world to name something a name is chosen that tells us exactly what the name means and whose behind it. Lucifer. But Im sure thats just a coincidence.
The name was coined over 100 years ago by the scientist who first characterized what it was, Raphael Dubois. The term is rooted in the Latin, ie pre Christianity, lux (light) and ferre (to bring).
My best friend, upon the birth of his second child, rushed to my house to tell me the good news. “What did you name him?”
“Trenton.” “You named your son after the capital of New Jersey?” (he’s from Dover, NJ)
**long pause as he realizes he never once considered this**
“Um. No. But now that you mention it…”
Not everyone notices this sort of thing.
“The term is rooted in the Latin, ie pre Christianity, lux (light) and ferre (to bring).”
Huh? What?! Latin preceded Christ?! Hmmmm?
What she said doesn’t seem much different than what is being researched at Rice University :
Quantum-dot tattoos hold vaccination record
Rice bioengineer reveals dissolving microneedles that also embed fluorescent medical info
https://news.rice.edu/news/2019/quantum-dot-tattoos-hold-vaccination-record
Thought,
Wellness,
Information,
Transitional
Training and
Enhanced
Re-education
I see what you did there…very witty!
So how does anyone know if Luciferase is or is not an ingredient in the vaxes if the ingredients are not listed anywhere?
Newsmax, the home for RINOs and any talk of Nov 3rd is verboten
Deleted my link to Newsmax over a week ago…THEY are part of the cabal…
Never underestimate any religion and the lengths to which its adherents will go to appear to be bat-scat crazy.
I am not happy with Newsmax for suspending. They did this 10 days before twitter. Anxious to see if Emerald will return to Newsmax.
I have sent an email to Newsmax informing them I don’t know which direction their newscast is heading, but I will not be along for the ride. Also told them to get bent.
Newsmax, Fox News, OAN are all the same. Corporate Head Fakes that act as “Conservative” networks. Lets Go Brandon!
Thought Newsmax was conservative, or at least NOT “mad-dog-left….”
Just wanted to let my fellow “Treepers” know some positive information on Covid: My wife and I(both over 65) had two Pfizer vaccinations back in Feb/March and both came down with Covid within the past 10 days(caught at a social gathering). After three days of misery and a positive home test, our doctor sent us to a local outpatient emergency department set up for monoclonal antibody treatment(Regeneron). By the way, there is another antibody treatment by Eli Lily approved by the FDA. Within 12 hours of the treatment, our symptoms were 95% better, and after 3 days, all symptoms were gone. This treatment is the current gold standard therapy, and is covered by Medicare Part B. We are in isolation for another week. Good health to you all.
By the way, the Abbott BinaxNow rapid antigen test is very accurate for positive results and inexpensive: $14 at Walmart or Amazon. Comes with two tests. Results in 15 minutes. Keep one in your house. It is accepted proof that you have covid with symptoms for treatment approval.
The treatment is an IV drip in your arm followed by a saline solution drip. Whole process takes 3-4 hours.
Thanks for all your info and glad you and your wife are in recovery!
Whatever the ingredients, and mostly there are 22 of them, WHY would one consider having the shots when they are for under EUA, .Emergency Use Authorization?
People are having horrible adverse reactions from death to debilitating diseases like Guillaime-Barre (sp! and others, like paralysis and neurological damage, just because of a slick marketing program by so-called celebs, politicians and ugh! Sesame Street characters.
Stop being fed fear instead of Faith and control over Freedom!
We are turning into North Korea more and more every damn day. Twitter sucks and Newsmax should have respected Emerald’s opinion and supported her. There are some good reporters at Newsmax, but when I saw that they had one of the first Russia disinformation actors from Showtime’s Circus working for them, it was a huge red flag for me. Turn the TV off, you’ll enjoy life much more and if you have high blood pressure, your body will thank you.
Jaw dropping essay from Emerald. ?????????
Hmmm, Misinfo, eh? Will the members of the compliance division of Thought, Wellness, Information, Transitional Training and Enhanced Re-education (aka ‘TWITTER’) be sent to their own re-education camp for a ‘tune-up’ when they start complaining to their Ministry of COVID Compliance about suffering from Vaxx caused Myocarditis and/or Pericarditis? Inquiring Minds, ya know!
Dear Emerald,
I am deeply saddened to see what has occurred. You are the best journalist I have ever seen. Newsmax has been turning into a different outfit and I don’t know why, but the change has been evident these last months. I think what they did to you was truly terrible. They have seriously changed these past months and they have actually been promoting the vaccines for children, which is truly evil!!!
Twitter just kicked me off and I had to repetitively appeal their decision. I had been telling people NOT to vaccinate their children and I think that this is why. This is all very heinous as we both know. Please let me know if there is anything I can do. I am furious that they thought to do this! I am happy to help and I will do what I can.
We are in a terrible battle as we both know. God, however, is at our side. I am a humble shepherdess at the edge of the wilderness, but I am doing everything I can to fight in this battle. Warm Regards, Elizabeth
The Second Edition of the 20-volume Oxford English Dictionary contains full entries for 171,476 words in current use (along with 47,156 obsolete words).
So why would it be necessary to use the word Luciferase… or Satin for testing products, with that volume of available words?
Reading all of your comments here… some naysayers included, just asking? Something is terribly wrong on the surface.
Wrong Think Plus True Facts = Permanent Bans from Suppression Media like Twitter
Especially when the True Facts threaten to unpack the meta-conspiracy that is Covid
Spelling error. Ms. Robinson’s account was suspended at “titter.”
Neither newsmax nor titter will survive long. The fault lines are clear now.
The increasingly powerful tremors of 2022 and 2024 will clear the playing field of the unfit.
Went full Vax too, so FK Fox , NM equally forever
The Lord of all Creation will protect those of us who believe in the Savior. His Power is infinite.
Satan and his minions scheme and plot, kill and destroy: but they will be blown away by the Almighty.
Stand fast, friends.
“But ye are a chosen generation, a royal priesthood, an holy nation, a peculiar people; that ye should show forth the praises of Him who hath called you out of darkness into His marvelous light.”
I Peter 2:9